ABSTRACT
En los últimos años, la trombosis de la vena porta entre los pacientes cirróticos se ha comportado como una entidad reconocida y cada vez más estudiada, no solo por su creciente incidencia, sino por la asociación con gravedad y mal pronóstico en cirrosis. Asimismo, se hacen objeto de estudio las terapias disponibles para el manejo tanto médico como quirúrgico de estos pacientes, lo que ha dado un papel importante a la derivación portosistémica transyugular intrahepática (TIPS). El uso de TIPS en esta población se posiciona como una alternativa de manejo aceptable, no solo por brindar mejoría en las complicaciones derivadas de la hipertensión portal, sino también por sus resultados prometedores en diferentes estudios sobre el flujo y la recanalización portal, y por su perfil de seguridad. Sin embargo, la eficacia, los efectos adversos a largo plazo y el pronóstico de dicha intervención en la compleja fisiopatología de la cirrosis deben continuar en estudio. El objetivo de este artículo es revisar los avances del uso de TIPS en el manejo de pacientes con cirrosis hepática y trombosis portal.
In recent years, portal vein thrombosis among cirrhotic patients has been a well-recognized and continuously studied entity, not only because of its increasing incidence but also because of its association with severity and poor prognosis in cirrhosis. Likewise, therapies available for both medical and surgical management in these patients are being studied, which has given an important role to the transjugular intrahepatic portosystemic shunt (TIPS). The use of TIPS in this population is positioned as an acceptable management alternative, not only because it provides improvement in complications derived from portal hypertension, but also because of its promising results in different studies on portal flow and recanalization upgrade, and for its safety. However, the efficacy, long-term adverse effects, and prognosis of this intervention in the complex pathophysiology of cirrhosis must continue to be studied. The objective of this article is to review the advances in the use of TIPS in the management of patients with liver cirrhosis and portal vein thrombosis.
ABSTRACT
Portal vein thrombosis is one of the common complications of liver cirrhosis. The incidence of portal vein thrombosis is increased with the progression of diseases. The incidence and progression of portal vein thrombosis are associated with multiple factors. The indications of anticoagulant therapy remain to be investigated. At present, portal vein thrombosis is no longer considered as a contraindication for liver transplantation. Nevertheless, complicated portal vein thrombosis will increase perioperative risk of liver transplantation. How to restore the blood flow of portal vein system is a challenge for surgical decision-making in clinical practice. Rational preoperative typing, surgical planning and portal vein reconstruction are the keys to ensure favorable long-term prognosis of liver transplant recipients. In this article, epidemiological status, risk factors, typing and identification of portal vein thrombosis, preoperative and intraoperative management of portal vein thrombosis in liver transplantation, and the impact of portal vein thrombosis on the outcomes of liver transplantation were reviewed, aiming to provide reference for perioperative management of portal vein thrombosis throughout liver transplantation.
ABSTRACT
Introducción: el colangiocarcinoma intrahepático es un cáncer agresivo de células epiteliales de los conductos biliares intrahepáticos y su desarrollo se asocia a inflamación crónica del árbol biliar. En Chile, su epidemiología es limitada y el presente estudio tiene por objetivo describir su tasa de mortalidad. Métodos: se realizó un estudio descriptivo observacional transversal y ecológico de las defunciones por carcinoma de vías biliares en Chile durante 2017 y 2021 según sexo, grupo etario y región de residencia. Resultados: la tasa de mortalidad nacional de personas mayores a 20 años durante el periodo estudiado fue de 1,56 por cada 100.000 habitantes. La tasa de mortalidad más alta del sexo masculino se observó en 2020, siendo de 2,61. La mayor mortalidad se encontró en personas mayores a 80 años en el sexo masculino con una tasa de 24,38. A nivel regional, en Magallanes se observó la mayor tasa de mortalidad con 5,66, mientras que Tarapacá presentó la menor tasa con un valor de 0,96. Finalmente, el índice de Swaroop fue igual o mayor al 92% en todas las regiones del país. Conclusión: la mayor mortalidad por colangiocarcinoma intrahepático se presenta en personas de edad avanzada y de sexo masculino. Interesantemente la mayor mortalidad por esta causa se concentra en la zona sur de Chile. Dada la magnitud del problema que representa esta enfermedad en la salud pública nacional es que futuros estudios son necesarios para establecer medidas de prevención y/o tratamiento de esta enfermedad.
Introduction: intrahepatic cholangiocarcinoma is an aggressive cancer of epithelial cells of the intrahepatic bile ducts, and its deve-lopment is associated with chronic inflammation of the biliary tree. In Chile, its epidemiology is limited, and the present study aims to describe its mortality rate. Methods: a descriptive, cross-sectional, observational, and ecological study of deaths from bile duct carcinoma in Chile between 2017 and 2021 was performed according to sex, age group, and region of residence. Results: the national mortality rate of people over 20 years old during the study period was 1.56 per 100,000 inhabitants. The highest mortality rate for the male sex was observed in 2020, with a value of 2.61. In turn, the highest mortality rate was found in people over 80 years old in the male sex, with a rate value of 24.38. On a regional level, Magallanes had the highest mortality rate, with a rate value of 5.66, while Tarapacá had the lowest rate, with a value of 0.96. Finally, Swaroop's index was equal to or greater than 92% in all regions of the country. Conclusion: the highest mortality from intrahepatic cholangiocarcinoma occurs in older people and males. Interestingly, the highest mortality from this cause is concentrated in the southern zone of Chile. Given the magnitude of the problem that this disease represents for national public health, future studies are necessary to establish both prevention measures and treatments
ABSTRACT
Background: Introduction: Intrahepatic cholestasis of pregnancy (ICP), is the most common liver disease specific to pregnancy. Previous studies of fetal effects have suggested that ICP is associated with a higher rate of adverse neonatal outcomes including preterm birth, neonatal respiratory distress syndrome (RDS), meconium-stained amniotic fluid, neonatal intensive care unit admission, and stillbirth. Material & Methods: This was a 4 year retrospective observational study including 43,344 female who delivered in our hospital out of which 1126 cases of ICP were identified, who were compared with 1136 age and parity matched controls. Results: : Previous history and family history of ICP was significant in the ICP group. Gestational diabetes and preterm labour were more frequent in the ICP group. Mean birth weight was lower in the ICP group, rate of small for gestational age foetuses was not significantly different. Cesearean section and post-partum haemorrhage was more frequent in the ICP group. Adverse neonatal outcomes i.e. respiratory distress syndrome (RDS) and need for NICU admission were more in the ICP group. Conclusion: ICP is associated with increased rate of preterm delivery, post-partum hemorrhage and increased neonatal morbidity. Management of patients with ICP should be individualized based on the severity of symptoms and associated medical complications.
ABSTRACT
Objective:To evaluate the efficacy and safety of quadruple therapy involving radiotherapy (RT), lenvatinib, anti-PD-1 antibody and GEMOX (oxaliplatin and gemcitabine) chemotherapy (quadruple therapy) in treatment cohort of patients with unresectable intrahepatic cholangiocarcinoma (ICC).Methods:The patients with recurrent, metastatic, or unresectable ICC underwent quadruple therapy at Zhongshan Hospital, Fudan University between September 2018 and May 2022 were selected. The data about efficacy and safety of quadruple therapy were collected in the hospital electronic medical record system. All patients were followed up regularly to obtain the long-term prognostic data until December 31, 2022. The efficacy, prognosis, and toxicity data were collected and analyzed.Results:A total of 41 patients were included in the analysis. After a median follow-up period of 15 months, disease progression was diagnosed in 36 patients (18 patients died), while 3 patients were lost to follow-up. The causes of death included liver failure induced by intrahepatic tumor progression ( n=6), distant metastases (lungs or brain, n=6), abdominal lymph node metastases ( n=3), cancer cachexia ( n=2), and unknown cause ( n=1). The median progression-free survival (PFS) was 11 months (95% CI: 9.2-12.8), and the median overall survival (OS) was 35 months (95% CI: 17.0-52.0). All patients experienced treatment-related adverse events (AEs) during the study treatment period. Of the 41 patients, 13 patients experienced at least once grade 3 or worse treatment-related AE, but all were manageable with symptomatic treatment. No treatment-related deaths were reported during the follow-up period. Conclusions:Radiotherapy (RT), lenvatinib, anti-PD-1 antibody and GEMOX in the treatment of unresectable ICC shows significant efficacy and good safety, which is worthy of clinical application.
ABSTRACT
ObjectiveTo investigate the prognostic value of the enhancement pattern in arterial phase of preoperative Gd-EOB-DTPA enhanced magnetic resonance imaging （MRI） in evaluating the disease-free survival （DFS） and overall survival （OS） in patients undergoing curative resection for intrahepatic cholangiocarcinoma （ICC）. MethodsA retrospective analysis was done on the clinical， preoperative MRI findings and postoperative follow-up results of 93 pathologically confirmed ICC patients undergoing surgery in our hospital between January 2018 and December 2021. Kaplan-Meier survival curves and log-rank test were used to compare the DFS and OS of three groups with different arterial enhancement patterns. Cox regression analysis was used to identify the factors affecting DFS and OS. ResultsThere were significant differences in DFS and OS among the 3 groups （log-rank test， P < 0.05）. The arterial enhancement pattern was an independent predictive factor for DFS （using diffuse hyperenhancement as a reference， peripheral rim enhancement： HR = 3.550； 95%CI： 1.16 ~ 10.8； P = 0.026；diffuse hypoenhancement： HR = 3.430； 95%CI： 1.04 ~ 11.3； P = 0.042）. The arterial enhancement pattern and tumor location were predictive factors for OS （（using diffuse hyperenhancement as a reference， diffuse hypoenhancement， HR = 8.500； 95%CI： 1.09-66.3； P = 0.041； using tumor distal location as a reference， tumor perihilar location HR=2.583，95%CI： 1.14-5.83， P =0.022）. The AUC of arterial enhancement patterns in predicting 1-， 2-， and 3- year DFS were 0.722， 0.748， and 0.617， respectively； in OS， 0.720， 0.704， and 0.730， respectively， which showed better prognostic efficacy than AJCC-TNM staging system. ConclusionArterial-phase enhancement pattern of preoperative Gd-EOB-DTPA enhanced MRI is an independent predictive factor for DFS and OS of ICC patients， with a better prognostic value than AJCC-TNM staging system， and can be used for the clinical management of ICC patients.
ABSTRACT
Primary intrahepatic stone （PIS）is one of the intractable diseases in hepatobiliary surgery and an important cause of death from benign biliary tract diseases, and it has a high prevalence in the Yangtze River basin and southeastern coastal areas of China. At present, the mechanism of PIS occurrence has not been fully elucidated, but the role of biliary flora in the formation of PIS has been recognized by more and more studies. This article reviews the research progress of biliary flora in the formation of PIS with a view to strengthening the clinical understanding of mechanism of PIS, increasing the attention to the detection of biliary flora, and providing a reference for the prevention and treatment of PIS and the improvement of prognosis.
ABSTRACT
Sarcopenia is a common complication of liver cirrhosis and is significantly associated with poor prognosis. Transjugular intrahepatic portosystemic shunt (TIPS) is an important method for the treatment of portal hypertension and its complications. Based on current studies, this article analyzes the association between sarcopenia and the outcomes (hepatic encephalopathy and mortality) of patients with liver cirrhosis after TIPS and the value of improving the predictive ability of existing prognostic models for sarcopenia, as well as the improvement in sarcopenia after TIPS and its significance in the clinical management of patients with liver cirrhosis. A comprehensive analysis of existing reports show that baseline sarcopenia is associated with poor prognosis after TIPS, and it is thus recommended to evaluate nutritional status before TIPS based on radiological examination; TIPS can improve nutritional status and help to achieve reversal or improvement of sarcopenia to a certain extent, and it can also be translated into survival benefit. Therefore, for patients with sarcopenia and a relatively stable disease, TIPS can be performed as soon as possible after comprehensive evaluation.
ABSTRACT
Refractory ascites is one of the common complications of portal hypertension in decompensated liver cirrhosis and is characterized by extremely poor prognosis and high mortality rate. Transjugular intrahepatic portosystemic shunt (TIPS) is recommended by several international and national guidelines as one of the treatment methods after failure of large volume paracentesis combined protein infusion therapy. TIPS can effectively control the recurrence of ascites, but it can increase the risk of hepatic encephalopathy, and there are still controversies over whether it can prolong survival time. With a deeper understanding of TIPS, the maturity of surgical techniques, and the update of stent materials, it is urgent to reevaluate the position of TIPS in the treatment of refractory ascites due to portal hypertension. This article reviews the current status and advances in TIPS for the treatment of refractory ascites due to portal hypertension.
ABSTRACT
Esophagogastric variceal bleeding (EGVB) is one of the main complications of decompensated portal hypertension, especially in patients with liver cirrhosis, and it often has a high mortality rate. Medication combined with endoscopy is the main prevention and treatment method for EGVB, while transjugular intrahepatic portosystemic shunt (TIPS) combined with variceal embolization can also be selected for some high-risk patients, and individualized diagnosis and treatment of portal hypertension based on hepatic venous pressure gradient should become the latest consensus and the main strategy. This article mainly reviews endoscopic therapy and TIPS for the prevention and treatment of EGVB patients with decompensated portal hypertension in terms of selection of indications, incidence rate of complications, and respective advantages and disadvantages.
ABSTRACT
Transjugular intrahepatic portosystemic shunt (TIPS) is a procedure to establish a portosystemic shunt between the hepatic vein and the portal vein via the jugular approach, so as to reduce portal venous pressure and control acute esophagogastric variceal bleeding (EGVB). The prognosis of EGVB has been improved significantly over the past few decades, and endoscopic variceal ligation combined with drug therapy is now recommended as the first-line treatment regimen for this disease. The latest research advances in the management of EGVB over the past decade have focused on the relatively new concept of "early" or "pre-emptive" TIPS, that is to say, early TIPS (within 72 hours after admission, ideally within 24 hours) is recommended for patients with EGVB who are at a relatively high risk of failure in standard treatment. This article briefly introduces the effect of early TIPS on controlling bleeding, mortality rate, and hepatic encephalopathy, the high-risk population for early TIPS, timing of intervention, cost effectiveness, the applications of early TIPS in a real-world setting, and recommendations for early TIPS in international guidelines and consensus statements.
ABSTRACT
Transjugular intrahepatic portosystemic shunt (TIPS) is a safe and effective method for the treatment of portal hypertension complications in patients with decompensated liver cirrhosis. At present, there are many prognostic scoring tools for risk stratification of poor prognosis after TIPS. This article briefly introduces seven prognostic scoring tools commonly used for TIPS and summarizes the clinical research evidence of each scoring tool. The literature review shows that there is currently no sufficient research evidence to determine the optimal prognostic scoring tool after TIPS. Future clinical studies should comprehensively explore the advantages and disadvantages of different scoring tools in predicting short- and long-term adverse prognostic events after TIPS and develop new prognostic scoring tools in combination with new prognostic markers.
ABSTRACT
Objective To compare the value of Child-Pugh score, Model for End-Stage Liver Disease (MELD) score, MELD combined with serum sodium concentration (MELD-Na) score, CLIF Consortium Acute Decompensation (CLIF-C AD) score, and Freiburg index of post-transjugular intrahepatic portosystemic shunt (TIPS) survival (FIPS) score in predicting the survival of patients undergoing TIPS. Methods A retrospective analysis was performed for the clinical data of 447 patients with liver cirrhosis who underwent TIPS in several hospitals in southwest China, among whom there were 306 patients in the survival group and 62 in the death group. The scores of the above five models were calculated, and a survival analysis was performed based on these models. The independent samples t -test was used for comparison of normally distributed continuous data between groups, and the non-parametric Mann-Whitney U test was used for comparison of non-normally distributed continuous data between groups; the Pearson chi-square test was used for comparison of categorical data between groups; a multivariate Cox regression analysis was used for correction analysis of known influencing factors with statistical significance which were not included in the scoring models; the Kaplan-Meier method was used to evaluate the discriminatory ability of each model in identifying risks in the surgical population, and the log-rank test was used for analysis. The area under the receiver operating characteristic curve (AUC), C-index at different time points, and calibration curve were used to evaluate the predictive ability of each scoring model. Results Compared with the death group, the survival group had significantly lower age ( Z =2.884, P < 0.05), higher albumin ( t =3.577, P < 0.05), and Na + ( Z =-3.756, P < 0.05) and significantly lower proportion of patients with alcoholic cirrhosis ( χ 2 =22.674, P < 0.05), aspartate aminotransferase ( Z =2.141, P < 0.05), prothrombin time ( Z =2.486, P < 0.05), international normalized ratio ( Z =2.429, P < 0.05), total bilirubin ( Z =3.754, P < 0.05), severity of ascites ( χ 2 =14.186, P < 0.05), and scores of the five models (all P < 0.05). Survival analysis showed that all scoring models effectively stratified the prognostic risk of the patients undergoing TIPS. Comparison of the C-index of each scoring model at different time points showed that Child-Pugh score had the strongest ability in predicting postoperative survival, followed by MELD-Na score, MELD score, and CLIF-C AD score, and FIPS score had a relatively poor predictive ability; in addition, the prediction efficiency of each score gradually decreased over time. Child-Pugh score had the largest AUC of 0.832 in predicting 1-year survival rate after surgery, and MELD-Na score had the largest AUC of 0.726 in predicting 3-year survival rate after surgery, but FIPS score had a poor ability in predicting 1- and 3-year survival rates. Conclusion All five scoring models can predict the survival of patients with liver cirrhosis after TIPS and can provide effective stratification of prognostic risk for such patients. Child-Pugh score has a better ability in predicting short-term survival, while MELD-Na score has a better ability in predicting long-term survival, but FIPS score has a relatively poor predictive ability in predicting both short-term and long-term survival.
ABSTRACT
Hepatic venous pressure gradient (HVPG) is the "gold standard" for the diagnosis of portal hypertension, which could be applied in the evaluation of liver cirrhosis. Combined use of HVPG with model for end-stage liver disease (MELD) scoring system may more accurately match the donors and recipients undergoing liver transplantation for liver cirrhosis, select the appropriate timing of surgery, and provide guidance for bridging treatment for patients on the waiting list for liver transplantation. Besides, HVPG may also predict clinical prognosis of liver transplant recipients, and provide evidence for early detection and intervention of potential complications. Therefore, the value of HVPG in preoperative evaluation and prognosis prediction of liver transplant recipients was reviewed, aiming to provide guidance for clinical diagnosis and treatment of liver transplant recipients before and after surgery.
ABSTRACT
Objective:To investigate the influence of lymphadenectomy on efficacy of patients with intrahepatic cholangiocarcinoma (ICC) at different locations.Methods:The retro-spective cohort study was conducted. The clinicopathological data of 123 patients with ICC who were admitted to the Affiliated Hospital of North Sichuan Medical College from January 2015 to January 2022 were collected. There were 78 males and 45 females, aged 55(rage, 50?60)years. All patients underwent radical resection. Observation indicators: (1) clinical characteristics of patients with ICC; (2) follow-up; (3) surgical situations in ICC patients with different number of lymph nodes dissected. Measurement data with normal distribution were represented as Mean± SD, and compari-son between groups was conducted using the independent sample t test. Measurement data with skewed distribution were represented as M(range), and comparison between groups was conducted using the Mann-Whitney U test. Count data were described as absolute numbers or percentages, and comparison between groups was conducted using the chi-square test. Kaplan-Meier method was used to draw survival curve and Log-Rank test was used for survival analysis. Results:(1) Clinical characteristics of patients with ICC. Of the 123 patients, 81 cases had peripheral ICC and 42 cases had central ICC. The albumin-bilirubin grade (grade 1, grade 2?3), preoperative lymph node metastasis risk assessment (low risk, high risk), the number of lymph nodes dissected (<6, ≥6), lymph node metastasis (positive, negative) were 57, 24, 51, 30, 49, 32, 15, 66 in patients with peripheral ICC, versus 19, 23, 17, 25, 14, 28, 16, 26 in patients with central ICC, showing significant differences in the above indicators between them ( χ2=7.40, 5.66, 8.17, 5.62, P<0.05). (2) Follow-up. All the 123 patients were followed up for 28(range, 21?38)months. The 3-year overall survival rate was 57.8% in the 81 patients with peripheral ICC, versus 32.3% in the 42 patients with central ICC, showing a significant difference between them ( χ2=5.98, P<0.05). Of the 42 patients with central ICC, there were 25 cases with high risk of lymph node metastasis before surgery and 17 cases with low risk of lymph node metastasis before surgery. Of the 25 central ICC patients with high risk of lymph node metastasis before surgery, the 3-year overall survival rate was 28.9% in the 18 cases with the number of lymph nodes dissected ≥6, versus 14.3% in the 7 cases with the number of lymph nodes dissected <6, showing a significant difference between them ( χ2=8.90, P<0.05). (3) Surgical situa-tions in patients with the different number of lymph nodes dissected. Of the 123 patients, cases with the number of lymph nodes dissected <6 and ≥6 were 63 and 60, and there was no significant difference in the operation time, intraoperative blood transfusion, postoperative complications, bile leakage, liver insufficiency, pulmonary infection, pleural effusion, abdominal effusion, or lymphatic leakage between them ( P>0.05). One patient might have multiple complications. Conclusions:The prognosis of patients with peripheral ICC is better than that of patients with central ICC. For patients with central ICC who are at high risk of lymph node metastasis before surgery, adequate lymph node dissection may result in a better prognosis.
ABSTRACT
Objective:To investigate the predictive value of controlled nutritional status (CONUT) score for overt hepatic encephalopathy (OHE) after transjugular intrahepatic portosys-temic stent-shunt (TIPSS) in Budd-Chiari syndrome patients.Method:The retrospective case-control study was conducted. The clinicopathological data of 48 Budd-Chiari syndrome patients who underwent TIPSS in the First Affiliated Hospital of Zhengzhou University from August 2014 to March 2021 were collected. There were 26 males and 22 females, aged (46±13)years. Observation indicators: (1) surgical situations and follow-up; (2) analysis of influencing factors of OHE after TIPSS; (3) predic-tion of OHE after TIPSS. Measurement data with normal distribution were represented as Mean± SD, and comparison between groups was performed using the t test. Measurement data with skewed distribution were represented by M( Q1, Q3), and comparison between groups was performed using the Mann-Whitney U test. Count data were expressed as absolute numbers or percentages, and comparison between groups was performed using the chi-square test or Fisher exact probability. Multivariate analysis was performed using the Logistic regression model with forward method. The receiver operating characteristic (ROC) curve was drawn and the area under the curve (AUC) was calculated to evaluate the efficacy. Comparison among AUC was performed using the Delong test. Results:(1) Surgical situations and follow-up. All 48 patients underwent TIPSS successfully, and the operation time of the 48 patients was (131±29)minutes. All patients were implanted with 8 mm covered stent. All 48 patients were followed up for 46(25,71)months, and there were 14 cases with OHE and 34 cases without OHE after TIPSS. Of the 14 cases with OHE, 12 cases were evaluated as West-Haven Ⅱ grade and 2 cases were evaluated as West-Haven Ⅲ grade. (2) Analysis of influencing factors of OHE after TIPSS. Results of multivariate analysis showed that history of hepatic encephalo-pathy and CONUT score were independent factors influencing the incidence of OHE of Budd-Chiari syndrome patients who underwent TIPSS ( odds ratio=8.36, 1.74, 95% confidence interval as 1.02?68.75, 1.12?2.69, P<0.05). (3) Prediction of OHE after TIPSS. Results of ROC curve showed that the AUC of the CONUT score, the Child-Pugh score of liver function and the integrated model of end-stage liver disease (iMELD) score in predicting the incidence of OHE after TIPSS was 0.77(95% confidence interval as 0.64?0.91, P<0.05), 0.71(95% confidence interval as 0.56?0.87, P<0.05) and 0.71(95% confidence interval as 0.53?0.88, P<0.05), respectively, and there was no significant difference between the AUC of the CONUT score and the Child-Pugh score of liver function or the iMELD score ( Z=0.84, 0.59, P>0.05). The optimal cutoff value of CONUT score in predicting the incidence of OHE after TIPSS was 7, with the sensitivity, specificity and Yodon index as 78.6%, 61.8% and 0.40, respectively. Conclusion:The CONUT score can be used to predict the incidence of OHE in Budd-Chiari syndrome patients who underwent TIPSS, and the discrimination of CONUT score is equivalent to the Child-Pugh score of liver function and the iMELD score.
ABSTRACT
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
ABSTRACT
The incidence of intrahepatic cholangiocarcinoma has been increasing worldwide in recent years. Hepatectomy is the first choice for surgical treatment of intrahepatic cholangiocarcinoma. However, due to high tumor invasion, early lymph node metastasis and other factors, only less than 30% of cases are resectable, and the overall prognosis of patients is very poor. Theoretically, liver transplantation can not only remove the tumor, but also replace the damaged liver. Therefore, many scholars have proposed liver transplantation for the treatment of intrahepatic cholangiocarcinoma in order to obtain better results. Intrahepatic cholangiocarcinoma was once listed as a contraindication of liver transplantation due to limited cases, tumor recurrence, and shortage of donors. However, with the optimization of recipient screening criteria and the development of neoadjuvant therapy, part of patients can also benefit from it, making liver transplantation a potential therapeutic strategy. Based on the literature review and the author′s experience, this article introduced the current situation of surgical treatment of intrahepatic cholangiocarcinoma, the comparison between hepatectomy and liver transplantation, the latest progress of liver transplantation treatment and the future challenges and solutions.
ABSTRACT
ObjectiveTo investigate the effect and mechanism of osthole on the proliferation and apoptosis in human intrahepatic cholangiocarcinoma HuCCT1 cells. MethodThe effect of 10， 20， 40， 80， and 120 μmol·L-1 osthole on the proliferation of HuCCT1 cells was detected by the cell counting kit-8 （CCK-8）. A blank group， and low-， medium-， and high-dose osthole groups （16， 32， and 64 μmol·L-1） were set up. The effect of osthole on cell clone formation rate was detected by colony formation assay. The effect of osthole on cell cycle and apoptosis was detected by flow cytometry. The effect of osthole on cell apoptotic morphology was detected by Hoechst 33342 fluorescent staining. The effect of osthole on cell cycle protein cyclin B1， proliferating cell nuclear antigen （PCNA）， cysteine-aspartic acid protease （Caspase）-9， Caspase-3， cleaved Caspase-9， cleaved Caspase-3， cleaved poly（ADP-ribose） polymerase （cleaved PARP）， B-cell lymphoma-2 （Bcl-2）， phosphorylated protein kinase B （p-Akt）， phosphorylated mammalian target of rapamycin （p-mTOR）， and phosphorylated ribosomal protein S6 （p-RPS6） was detected by Western blot. ResultThe cell viability in the osthole group（40，80，120 μmol·L-1） decreased （P<0.05，P<0.01）， with the half maximal inhibitory concentration （IC50） of 63.8 μmol·L-1 as compared with that in the blank group. Compared with the blank group， the osthole groups（32，64 μmol·L-1）showed reduced clone formation rate （P<0.01）， increased number of cells in the G2 phase （P<0.05，P<0.01）， decreased number of cells， increased pyknosis and fragmentation， increased apoptosis rate （P<0.05，P<0.01）， down-regulated expression of cyclin B1， PCNA， Bcl-2， Caspase-3， Caspase-9， p-Akt， p-mTOR， and p-RPS6 （P<0.05，P<0.01）， and up-regulated expression of cleaved Caspase-3， cleaved Caspase-9， and cleaved PARP （P<0.05，P<0.01）. ConclusionOsthole can inhibit the proliferation and promote the apoptosis of HuCCT1 cells， and its mechanism may be related to the Akt/mTOR signaling pathway.
ABSTRACT
Objective To summarize the diagnosis and treatment experience of portal vein aneurysm after liver transplantation. Methods Clinical data of two recipients with portal vein aneurysm after liver transplantation were retrospectively analyzed. Clinical features, diagnosis, treatment and prognosis were summarized based on literature review. Results Both two cases were diagnosed with intrahepatic portal vein aneurysm complicated with portal vein thrombosis and portal hypertension after liver transplantation. Case 1 was given with targeted conservative treatment and he refused to undergo liver retransplantation. Physical condition was worsened after discharge, and the patient eventually died from liver graft failure, kidney failure, lung infection, and septic shock. Case 2 received high-dose glucocorticoid pulse therapy, whereas liver function was not improved, and the patient was recovered successfully after secondary liver transplantation. Conclusions Long-term complication of portal vein aneurysm (especially intrahepatic type) after liver transplantation probably indicates poor prognosis. Correct understanding, intimate follow-up and active treatment should be conducted. Liver retransplantation may be a potential treatment regimen.